View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20824_high_15 (Length: 334)
Name: NF20824_high_15
Description: NF20824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20824_high_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 23 - 326
Target Start/End: Original strand, 44467237 - 44467540
Alignment:
| Q |
23 |
atcatcaactgtatcgaaaaatgaatgcatctcatcataattatcttcaacaactccttgttggacagatgatagtggctgcgactctgaggtaaccaat |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44467237 |
atcatcaactgtatcgaaaaatgaatgcatctcatcataattatcttcaacaactccttgttggacagatgatagtggctgcgactctgaggtaaccaat |
44467336 |
T |
|
| Q |
123 |
ttatgaggttgcattgctattgaactgctattattatttgtgtaagggcactgaagccacaaattaggatttgtagcatcatcctttgaatccatgtaga |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
44467337 |
ttatgaggttgcattgctattgaactgctattattatttgtgtaagggcactgaagccacaaattaggatttgtagcatcatcttttgaatccatgtaga |
44467436 |
T |
|
| Q |
223 |
gggaggagttattataatccacactattgctgttggagtaggaatgttgctgagatatagacaaagatgcagcaactgtgttattgttgttataagtctg |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44467437 |
gggaggagttattataatccacactattgctgttggagtaggaatgttgctgagatacagacaaagatgcagcaactgtgttattgttgttataagtctg |
44467536 |
T |
|
| Q |
323 |
tggt |
326 |
Q |
| |
|
|||| |
|
|
| T |
44467537 |
tggt |
44467540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University