View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20824_high_9 (Length: 349)
Name: NF20824_high_9
Description: NF20824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20824_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 22 - 335
Target Start/End: Original strand, 38604383 - 38604697
Alignment:
| Q |
22 |
catcatcatcaacaataacgccgtttccatccacagaacctcttgtccatttgcgtgccacacttgccgccgatctactttctttccaaccccacctctc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38604383 |
catcatcatcaacaataacgccgtttccatccacagaacctcttgtccatttgcgtgccacacttgccgccgatctactttctttccaaccccacctctc |
38604482 |
T |
|
| Q |
122 |
tgacgtacacctctctcagttcaacacttcacgttttcatcaatttttacgnnnnnnnnattg-aaaagcttgttttttagtactactttgagctcagct |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38604483 |
tgacgtacacctctctcagttcaacacttcccgttttcataaatttttacgtttttttttttggaaaagcttgttttttagtactactttgagctcagct |
38604582 |
T |
|
| Q |
221 |
agttttttctgttacatagttgttgatttgtaaaattggaagagttcatgattagttgcttgtactgttgtacttgattatgtggattgctcttaattgg |
320 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38604583 |
agttttttctgttacataattgttgatttgtaaaattggaagagttcatgattagttgcttgtactgttgtacttgattatgtggattgctcttaattgg |
38604682 |
T |
|
| Q |
321 |
aaccatggttgtgtc |
335 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
38604683 |
aaccatggttgtgtc |
38604697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University