View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20825_high_5 (Length: 304)
Name: NF20825_high_5
Description: NF20825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20825_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 30 - 247
Target Start/End: Complemental strand, 3332715 - 3332498
Alignment:
| Q |
30 |
acatggacattcacttcctccacctttccacacagcaagagatcttcatcttcaccatcaacaccagcagcagcaacaacaacgacaacaccatcaattc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
3332715 |
acatggacattcacttcctccacctttccacacagcaagagatcttcatcttcaccatcaacaccaacagcagcaacaacaacaacaacaccatcaattc |
3332616 |
T |
 |
| Q |
130 |
cacactttacagcagcagcaacaaaccacagatcaagatgaacaaagcggaagtagcagcggcggtggactcaacctcacaaaccgagaagaaaacagca |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3332615 |
cacactttacagcagcagcaacaaaccacagatcaagatgaacaaagcggaagtagcagcggcggtggactcaacctcacaaaccgagaagaaaacagca |
3332516 |
T |
 |
| Q |
230 |
acaacaagttcagcacag |
247 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
3332515 |
acaacaagttcagcacag |
3332498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University