View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20826_high_3 (Length: 325)
Name: NF20826_high_3
Description: NF20826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20826_high_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 9 - 296
Target Start/End: Original strand, 40472715 - 40473003
Alignment:
| Q |
9 |
gagatgaaaccaaaatcgaaccgccaaaataaccacaccatagtagtggtccgttcaaggttcactcggttggaacttccagt-cggtttttaaaacact |
107 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
40472715 |
gagacgaaaccaaaatcgaactgccaaaataaccacaccatagtagtggtccgttcaaggttcactcggttggaacttccagttcagtttttaaaacact |
40472814 |
T |
|
| Q |
108 |
gcattatggtatgttgcactgaatgttcacctgagaaggggggatattcattgctggcttgaacctcactgtctttggcctaatggcggatattgtagtt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40472815 |
gcattatggtatgttgcactgaatgttcacctgagaaggggggatattcattgctggcttgaacctcactgtctttggcctaatggcggatattgtagtt |
40472914 |
T |
|
| Q |
208 |
tgagaagatgcaattggaggagtggaatcgattgcacctgctagaagttctgagaaagatttgtaagaagaacaagtaggccttgaagc |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40472915 |
tgagaagatgcaattggaggagtggaatcgattgcacctgctagaagttctgagaaagatttgtaagaagaacaagtaggccttgaagc |
40473003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University