View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20826_high_4 (Length: 318)
Name: NF20826_high_4
Description: NF20826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20826_high_4 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 11 - 318
Target Start/End: Original strand, 171690 - 171997
Alignment:
| Q |
11 |
atcctggagaggaaggaggttatggcttccctcttgaacctgcaaagttaagatcacgtaatatcttctctcattcgggccagtcaatgcatccaagtgc |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
171690 |
atcctgaagaggaaggaggttatggcttccctcttgaacctgcaaagttaagatcacgtaatatcttctctcattcgggccagtcaatgcatccaagtgc |
171789 |
T |
 |
| Q |
111 |
atatggatcgtcgagtgatatgaatttgaaagaggaagctgctctttctggccctgatcgtgttttcacatcaagaaaaattgaattgagaaaacaaaat |
210 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
171790 |
atatggatcgtcgcgcgatatgaatttgaaagaggaagctgctcttcctggccctgatcgtgttttcacatcaagaaaaattgaattgagaaaacaaaat |
171889 |
T |
 |
| Q |
211 |
tcttattggcacggtagtactgcacaattgtcaagattttctaattcagttgcaattcgaggtgattcacgaattgatatgagtggagactgtagtttga |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
171890 |
tcttattggcacggtagtactgcacaattgtcaagattttctaattcagttgcaattcgaggtgattcacaacttgatatgagtggagactgtagtttga |
171989 |
T |
 |
| Q |
311 |
actcacag |
318 |
Q |
| |
|
|||||||| |
|
|
| T |
171990 |
actcacag |
171997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University