View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20826_high_5 (Length: 316)
Name: NF20826_high_5
Description: NF20826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20826_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 9 - 193
Target Start/End: Complemental strand, 3652962 - 3652773
Alignment:
| Q |
9 |
cccaattttatatcgactggttaacaacatcatagtgatttgacatgtaatagttagtacttgttttgttaatttttagtcatgtttgtgtttttgtc-- |
106 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3652962 |
cccaattttatatcgactggttaagaacatcatagtgatttgacatgtaatagttagtacttgttttgttaatttttagtcgtgtttgtgtttttgtcaa |
3652863 |
T |
 |
| Q |
107 |
---aacnnnnnnnnntagtaagttgtgtcgatgttcttttctgtctagctttggtatgctttaaggtctatatttaaaagttgggttgaa |
193 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3652862 |
aaaaaaaaaaaaaaatagtaagttgtgtcgatgttcttttctgtctagctttggtatgctttaaggtctatatttaaaagtttggttgaa |
3652773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University