View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20827_high_12 (Length: 335)
Name: NF20827_high_12
Description: NF20827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20827_high_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 180; Significance: 4e-97; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 180; E-Value: 4e-97
Query Start/End: Original strand, 50 - 293
Target Start/End: Complemental strand, 19159316 - 19159073
Alignment:
| Q |
50 |
caccacagacgtccagattggcagcaatattattccgataagaacaacttctttgatcagcacagtttcgatgaatttccctatgcaagggcagtctgat |
149 |
Q |
| |
|
||||||| || ||||||||||||||| ||||||||||||||| | ||||||||||||||||||| ||||||||||||||||||||||||||||| ||| |
|
|
| T |
19159316 |
caccacaaacatccagattggcagcagtattattccgataaggataacttctttgatcagcacaatttcgatgaatttccctatgcaagggcaggacgat |
19159217 |
T |
 |
| Q |
150 |
cgagagataccatggtcctacgcgatggtggttatcaggtgcataatcatacgcgttccaattatcgttcctacgggaaagagaatgtgcaccctgtgga |
249 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
19159216 |
cgagagataccatggtcttgcgcgatggtggttatcaggtgcaaaatcatacgcgttccaattatcgttcctacgggaaagagaatatgcaccatgtgga |
19159117 |
T |
 |
| Q |
250 |
taccattgaggctgatcacatgaaataaaggaaggtacacaggt |
293 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
19159116 |
taccattgaggttgatcacgtgaaataaaggaaggtacacaggt |
19159073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University