View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20828_high_13 (Length: 313)
Name: NF20828_high_13
Description: NF20828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20828_high_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 29 - 295
Target Start/End: Complemental strand, 55666186 - 55665920
Alignment:
| Q |
29 |
agagtcttcctgcaattgttgctatggtctggtcggatgataacagcaaacaactagaaggagctactaaatttaggaagcttcttttgacacacaaccc |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55666186 |
agagtcttcctgcaattgttgctatggtctggtcggatgataacagcaaacaactagaaggagctactaaatttaggaagcttcttttgacacacaaccc |
55666087 |
T |
|
| Q |
129 |
tcccatcgagaaaatcattcaatcctttgttgtaactcgatttctcgaatttatactgagggatgattttcctaaacttcgggtttgtttcaaacttgtc |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55666086 |
tcccatcgagaaaatcattcaatcctttgttgtaactcgatttctcgaatttataccgagggatgattttcctaaacttcgggtttgtttcaaacttgtc |
55665987 |
T |
|
| Q |
229 |
taccttttggaaatttatgttgtatggtgtagttgaannnnnnnngtttgtatgactttgtttgttt |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
55665986 |
taccttttggaaatttatgttgtatggtgtagttgaattttttttgtttgtatgactttgtttgttt |
55665920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 38 - 80
Target Start/End: Complemental strand, 55660065 - 55660023
Alignment:
| Q |
38 |
ctgcaattgttgctatggtctggtcggatgataacagcaaaca |
80 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
55660065 |
ctgcaatagttgctatggtctggtcggatgataacagccaaca |
55660023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University