View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2082_high_10 (Length: 236)
Name: NF2082_high_10
Description: NF2082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2082_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 45675513 - 45675733
Alignment:
| Q |
1 |
taatgtaaatgtgagtattttaatttaattttacatactccatggctagtaccatatgctgcttgagtgtatgtttcgttcactttgaagggatcaaaat |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45675513 |
taatgtaaatgtgagtatcttaatttaattttacattctccatggctagtaccatatgctgcttgagtgtatgtttcgttcactttgaagggatcaaaat |
45675612 |
T |
 |
| Q |
101 |
cgacggtagagatgttatattgattttgatgtgtttgattgttttaaagtagatttggtgtatctttggtttcctgtttgcaacacacaatagcacgttt |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
45675613 |
cgacggtagaaatgttatattgattttgatgtgtttgattgttttaaagtagatttggtgtatctttggtttcccgtttgcaacacacaataacacgttt |
45675712 |
T |
 |
| Q |
201 |
gtacatttttcgatgtgtttt |
221 |
Q |
| |
|
||||| |||||||| |||||| |
|
|
| T |
45675713 |
gtacacttttcgatttgtttt |
45675733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 165 - 201
Target Start/End: Complemental strand, 43292875 - 43292839
Alignment:
| Q |
165 |
tttggtttcctgtttgcaacacacaatagcacgtttg |
201 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
43292875 |
tttggtttcctgtttgcaccacacaaaagcacgtttg |
43292839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University