View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2082_high_11 (Length: 235)
Name: NF2082_high_11
Description: NF2082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2082_high_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 49074610 - 49074830
Alignment:
| Q |
1 |
tgatctttatagtaatatatctaaggtattttctgaaagatatgcatataccttagtgcttgtaatcggttggaagtatcgtggactccttgactttact |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
49074610 |
tgatctttatagtaatatatctaaggtattttctgaaagatatgcatataccttagtgcttgtaatcggttagaagtatcgtggactcgttgactttact |
49074709 |
T |
|
| Q |
101 |
aaggaaatactctttgtaaaaggaggattgggcataactgtctaagtttggagataaatcagtataaaactcaacatgtctttatctctatccatgtttc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
49074710 |
aaggaaatactctttgtaaaaggaggattgggcataactgtctaagtttggagataaatcagtataaaactcaacgtgtctttatctctatccatgtttc |
49074809 |
T |
|
| Q |
201 |
tctttacttgacgttctattt |
221 |
Q |
| |
|
||||||||| ||||||||||| |
|
|
| T |
49074810 |
tctttacttaacgttctattt |
49074830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University