View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20830_high_1 (Length: 350)
Name: NF20830_high_1
Description: NF20830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20830_high_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 2e-68; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 24 - 155
Target Start/End: Original strand, 50459546 - 50459677
Alignment:
| Q |
24 |
tcatcatacagtggtcgcactgggacttcttaagtgaaatggagtttgatcttttgtggattctcaacatccttcaaacttttcctcaattgcagaaact |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50459546 |
tcatcatacagtggtcgcactgggacttcttaagtgaaatggagtttgatcttttgtggattctcaacatccttcaaacttttcctcaattgcagaaact |
50459645 |
T |
|
| Q |
124 |
ttcaatcatggtgagtgaacatgcttaatacc |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
50459646 |
ttcaatcatggtgagtgaacatgcttaatacc |
50459677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 114; E-Value: 9e-58
Query Start/End: Original strand, 201 - 318
Target Start/End: Original strand, 50459723 - 50459840
Alignment:
| Q |
201 |
gagccatggcttcattcataaattaagttattcttttgatctggtgagtcatgaaaaaagatcatatatgtttaaaacatcctattatgctaacaccaat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50459723 |
gagccatggcttcattcataaattaagttattcttttgatctggtgagtcatgaaataagatcatatatgtttaaaacatcctattatgctaacaccaat |
50459822 |
T |
|
| Q |
301 |
tgagtttaatgcactttc |
318 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
50459823 |
tgagtttaatgcactttc |
50459840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 46; Significance: 3e-17; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 73 - 146
Target Start/End: Complemental strand, 47051406 - 47051333
Alignment:
| Q |
73 |
tcttttgtggattctcaacatccttcaaacttttcctcaattgcagaaactttcaatcatggtgagtgaacatg |
146 |
Q |
| |
|
||||||||||||| | ||||| |||||| ||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47051406 |
tcttttgtggattttaaacatgcttcaagcttctcctcttttgcagaaactttcaatcatggtgagtgaacatg |
47051333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 73 - 145
Target Start/End: Original strand, 47929059 - 47929131
Alignment:
| Q |
73 |
tcttttgtggattctcaacatccttcaaacttttcctcaattgcagaaactttcaatcatggtgagtgaacat |
145 |
Q |
| |
|
||||||||||||| | |||||||||||| ||| ||||| |||||||||| || ||||||||||||||||| |
|
|
| T |
47929059 |
tcttttgtggattttaaacatccttcaagcttctcctcttctgcagaaactctctgtcatggtgagtgaacat |
47929131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 63 - 145
Target Start/End: Complemental strand, 48107588 - 48107506
Alignment:
| Q |
63 |
tggagtttgatcttttgtggattctcaacatccttcaaacttttcctcaattgcagaaactttcaatcatggtgagtgaacat |
145 |
Q |
| |
|
|||||| ||||| ||| |||||| | |||||||||||| || |||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
48107588 |
tggagtatgatcctttatggattttaaacatccttcaagtttgtccttttttgcagaaactttcagccatggtgagtgaacat |
48107506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University