View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20832_high_4 (Length: 386)
Name: NF20832_high_4
Description: NF20832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20832_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 345; Significance: 0; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 345; E-Value: 0
Query Start/End: Original strand, 7 - 355
Target Start/End: Complemental strand, 29316906 - 29316558
Alignment:
| Q |
7 |
gtatcataggactacgtaatgtcatgagtaaaaaacttccagttagggatgttacaacattatgcgataccgcagtagcagctcttggaaaaatctacga |
106 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29316906 |
gtatcataagactacgtaatgtcatgagtaaaaaacttccagttagggatgttacaacattatgcgataccgcagtagcagctcttggaaaaatctacga |
29316807 |
T |
|
| Q |
107 |
atttcatcgtgacaatgtcggccctaaggtaataatctcccaaaatagattctcttaaccttcgtctgtgggactaattttgtagcaaagcctgaaacct |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29316806 |
atttcatcgtgacaatgtcggccctaaggtaataatctcccaaaatagattctcttaaccttcgtctgtgggactaattttgtagcaaagcctgaaacct |
29316707 |
T |
|
| Q |
207 |
aagcacggtggatagaatgaatgaccatgagagttacaatagtaatttatacttctgcaactgttgatcctcaatcataatgcttttaagcaggcggttc |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29316706 |
aagcacggtggatagaatgaatgaccatgagagttacaatagtaatttatacttctgcaactgttgatcctcaatcataatgcttttaagcaggcggttc |
29316607 |
T |
|
| Q |
307 |
aaaaatggttaagtttcttgccattgaagcaagatttcgacgaagctag |
355 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29316606 |
aaaaatggttaagtttcttgccattgaagcaagatttcgacgaagctag |
29316558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 72 - 153
Target Start/End: Complemental strand, 29327485 - 29327404
Alignment:
| Q |
72 |
gataccgcagtagcagctcttggaaaaatctacgaatttcatcgtgacaatgtcggccctaaggtaataatctcccaaaata |
153 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||| ||||||||| |||| ||| ||||||||||| |||||||| |
|
|
| T |
29327485 |
gataccgcagttgcagctcttggaaaaatctgtgaatttcaccgtgacaataccggctctatggtaataatcttccaaaata |
29327404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 290 - 344
Target Start/End: Complemental strand, 29298375 - 29298321
Alignment:
| Q |
290 |
ttttaagcaggcggttcaaaaatggttaagtttcttgccattgaagcaagatttc |
344 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
29298375 |
ttttaatcaggcggttcaaaaatggttaaacttcttgccattgaagcatgatttc |
29298321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 62 - 120
Target Start/End: Original strand, 42285545 - 42285603
Alignment:
| Q |
62 |
aacattatgcgataccgcagtagcagctcttggaaaaatctacgaatttcatcgtgaca |
120 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||| ||||| |||||||| ||||||| |
|
|
| T |
42285545 |
aacattatgtgataccgcagttgcagctcttggaagaatctgtgaatttcaccgtgaca |
42285603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University