View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20833_high_6 (Length: 323)
Name: NF20833_high_6
Description: NF20833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20833_high_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 83; Significance: 3e-39; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 30 - 112
Target Start/End: Complemental strand, 43568032 - 43567950
Alignment:
| Q |
30 |
agaagattaatgaaggaaaaaggggttagaaaacaacctggatatagtctcattgagatagacggaaaaactcatgagtttac |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43568032 |
agaagattaatgaaggaaaaaggggttagaaaacaacctggatatagtctcattgagatagacggaaaaactcatgagtttac |
43567950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 189 - 267
Target Start/End: Complemental strand, 43567877 - 43567799
Alignment:
| Q |
189 |
gttagcagggtacatgggaaatactagtgaggcattgtttgacatagatgaggaggaaaaagaagatgcacttcacagg |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43567877 |
gttagcagggtacatgggaaatactagtgaggcattgtttgacatagatgaggaggaaaaagaagatgcacttcacagg |
43567799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University