View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20834_high_4 (Length: 362)
Name: NF20834_high_4
Description: NF20834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20834_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 1 - 333
Target Start/End: Complemental strand, 11697268 - 11696936
Alignment:
| Q |
1 |
cctgagttgttttgattcaacatgaaaagattctcggctgcaatctcgccaatttctaagttatgatgaactttacaagcacttaaaaggctcctccaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11697268 |
cctgagttgttttgattcaacatgaaaagattctcggctgcaatcttgccaatttctaagttatgatgaactttacaagcacttaaaaggctcctccaaa |
11697169 |
T |
|
| Q |
101 |
ttacatcattaggcttgattgacatgctctttatgagttcataggcttcctttagcatcccaaatcttcccaacagatccaccatgcaaccataatgctg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11697168 |
ttacatcattaggcttgattgacatgctctttatgagttcataggcttcctttagcatcccaaatcttcccaacagatccaccatgcaaccataatgctg |
11697069 |
T |
|
| Q |
201 |
aactgttggttcaatcgtatgctcaaattgcatgcttttgaaacattgtagaccctcctcgacaagaccagcatgactgcaagcactaaatacgccaaca |
300 |
Q |
| |
|
||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11697068 |
aaccgttggttcaatcttatgctcaaattgcatgcttttgaaacattgtagaccctcctcgacaagaccagcatgactgcaagcactaaatacgccaaca |
11696969 |
T |
|
| Q |
301 |
tagacaacatcatctggtgccaaaccttcttca |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
11696968 |
tagacaacatcatctggtgccaaaccttcttca |
11696936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University