View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20836_high_17 (Length: 314)
Name: NF20836_high_17
Description: NF20836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20836_high_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 73 - 303
Target Start/End: Complemental strand, 26102903 - 26102673
Alignment:
| Q |
73 |
gatgaacaaccattagcctgtggttttcttaatctaaattcaaaagtcttatacactactcttcagaatgagagaaaaggcatcatgcatgcggtttgtt |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
26102903 |
gatgaacaaccattagcctgtggttttcttaatctaaattcaaaagtcctatacactactcttcagaatgagagaaaaggcaacatgcatgcggtttgtt |
26102804 |
T |
|
| Q |
173 |
ctgtatattgggaaccataccctatatacagagtttgtggccaatgtgaatttgaattatgtctacaaattttgacgataatcagatattattttatatg |
272 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
26102803 |
ctgtatattgcagaccataacctatatacagagtttgtggccaatgtcaatttgaattatgtctacaaattttgacgataatcatatattattttatatg |
26102704 |
T |
|
| Q |
273 |
ccaacgagttctatcaaaattaacgtcctat |
303 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |
|
|
| T |
26102703 |
ccaacgagttctatcaaaattaacatcctat |
26102673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 20 - 53
Target Start/End: Complemental strand, 26102935 - 26102902
Alignment:
| Q |
20 |
gacatcatcatatctaaagggatggacggtggga |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
26102935 |
gacatcatcatatctaaagggatggacggtggga |
26102902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University