View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20839_high_7 (Length: 309)
Name: NF20839_high_7
Description: NF20839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20839_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 51 - 281
Target Start/End: Complemental strand, 38556060 - 38555830
Alignment:
| Q |
51 |
ctaaaaataattattttgtaagttgaccttggtagatagacgagtgtacttttaggtgataagacttcttatgcaatcaaaagttataggcgagactata |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
38556060 |
ctaaaaataattattttgtaagttgaccttggtagatagatgagtgtactttgaggtgataagacttcttatgcgatcgaaagttataggcgagactata |
38555961 |
T |
|
| Q |
151 |
atagctaagagaggggagttgattctttgtcaataccactaacgcagtacgttggtcgtggagacctcatactgagtcaaaatatagtggagactggaca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38555960 |
atagctaagagaggggagttgattctttgtcaatgccactaacgcagtacgttggtcgtggagacctcatactgagtcaaaatatagtggagattggaca |
38555861 |
T |
|
| Q |
251 |
atggtgcacaaaacttatgttccatgtttgt |
281 |
Q |
| |
|
||| ||||||||||| ||||||||||||||| |
|
|
| T |
38555860 |
atgatgcacaaaactcatgttccatgtttgt |
38555830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 23 - 55
Target Start/End: Complemental strand, 38556150 - 38556118
Alignment:
| Q |
23 |
atcatcatatatattggacaaagagcaactaaa |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
38556150 |
atcatcatatatattggacaaagagcaactaaa |
38556118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University