View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2083_low_5 (Length: 255)
Name: NF2083_low_5
Description: NF2083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2083_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 35 - 243
Target Start/End: Original strand, 39933743 - 39933951
Alignment:
| Q |
35 |
tacccttataaggaaattgctctttaggcacctagnnnnnnnnctgaacggtggttaattaccgttcagtaggacacgcgagaaacatatagtgtgataa |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
39933743 |
tacccttataaggaaattgctctttaggcacttagtaaaaaaactgaacggtggttaattaccattcagtaggacacgcaagaaacatatagtgagataa |
39933842 |
T |
 |
| Q |
135 |
aagtaagatcgtccatannnnnnnagcctagcctgttatatgtctatttgttggaggatccagggtgttcaagggctccaggcccactaaatttttattc |
234 |
Q |
| |
|
||||| ||||||||||| ||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39933843 |
aagtatgatcgtccatatttttttagcctagcctgctatatgtctatttgttggtggatccagggtgttcaagggctccaggcccactaaatttttattc |
39933942 |
T |
 |
| Q |
235 |
ccattttca |
243 |
Q |
| |
|
||||||||| |
|
|
| T |
39933943 |
ccattttca |
39933951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University