View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20840_high_7 (Length: 305)
Name: NF20840_high_7
Description: NF20840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20840_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 32 - 297
Target Start/End: Complemental strand, 43114291 - 43114026
Alignment:
| Q |
32 |
gattcctacaccccccacatgcaactgcactcccacagtatctgccattgctagaaacagaacaaaacaagcttttgtctaacatgtagtaacacaaaag |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43114291 |
gattcctacaccccccacatgcaactgcactcccacagtatctgccattgctagaaacagaacaaaacaagcttttatctaacatgtagtaacacaaaag |
43114192 |
T |
|
| Q |
132 |
ttcactcttctctttcactctctctcttttattcaattatcagagagacacagtttgacacttgttcagtccgttccctgtcatggcatgcttaatacac |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43114191 |
ttcactcttctctttcactctctctcttttattcaattatcagagagacacagtttgacacttgttcagtccgttccctgtcatggcatgcttaatacac |
43114092 |
T |
|
| Q |
232 |
ccctcacatttattactttttaccactttgccatttccatttattactatttcagtgtttcatctc |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43114091 |
ccctcacatttattactttttaccactttgccatttccatttattactatttcagtgtttcatctc |
43114026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University