View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20842_high_4 (Length: 312)
Name: NF20842_high_4
Description: NF20842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20842_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 33 - 156
Target Start/End: Complemental strand, 50484423 - 50484300
Alignment:
| Q |
33 |
ttttcattttgtaaatattcatcgaagtttaatagtgttgacatccaaattgatccgaatcaataaaaaatttaagtacaaattgattcaaaagaaattg |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
50484423 |
ttttcattttgtaaatattcatcgaagtttaatagtgttgacatccaaattgatccgaatcaatgaaaaatttaagtacaaattgattcaaaagaaattg |
50484324 |
T |
|
| Q |
133 |
aaaaccgagcaatattgattgctt |
156 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
50484323 |
aaaaccgagcaatattgattgctt |
50484300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University