View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20849_high_11 (Length: 316)
Name: NF20849_high_11
Description: NF20849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20849_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 10 - 296
Target Start/End: Complemental strand, 6362618 - 6362332
Alignment:
| Q |
10 |
gcagagagcatgttgagcagtgaggacattgcattagatgaaaacactttagaggaagagctacagaatgcaattgctgaggagaattatgctaaagctg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6362618 |
gcagagagcatgttgagcagtgaggacattgcattagatgaaaacactttagaggaagagctacagaatgcaattgctgaggagaattatgctaaagctg |
6362519 |
T |
|
| Q |
110 |
cagaaataagggatacactaaaaaacctacaaaaagatagcaacacagcagtatttggagcaaacagcaagttttatgattcattcaggaatggcgacct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6362518 |
cagaaataagggatacactaaaaaacctacaaaaagatagcaacacagcagtatttggagcaaacagcaagttttatgattcattcaggaatggcgacct |
6362419 |
T |
|
| Q |
210 |
tgcagccatgcaaggtatgtgggcaaaaacggacgaggtatgctgtgttcatcctggtatgaaaggaatatccggttatgatgatgt |
296 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6362418 |
tgcagccatgcaaggtatgtgggcaaaaatggacgaggtatgctgtgttcatcctggtatgaaaggaatatccggttatgatgatgt |
6362332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University