View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2084_high_1 (Length: 354)
Name: NF2084_high_1
Description: NF2084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2084_high_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 17 - 342
Target Start/End: Complemental strand, 7665384 - 7665059
Alignment:
| Q |
17 |
tcaacaccacccccacaccagtccccgaggcatctgtttctaacacgaatggtagtgaaaaatcaggaagattaagtacaggggttgtagttaagactta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7665384 |
tcaacaccacccccacaccagtccccgaggcatctgtttctaacacgaatggtagtgaaaaatcaggaagattaagtacaggggttgtagttaagactta |
7665285 |
T |
 |
| Q |
117 |
agacatgcttcaatttaacaaaagttgtttgagcatcttcagtccatgcaaatgcctctttcttcaatagactagtcaatagaagagaatgatgaaatca |
216 |
Q |
| |
|
||| |||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7665284 |
ggacctgcttcaatttatcaaaagctgtttgagcatcttcagtccatgcaaatgcctctttcttcaatagattagtcaatagaagagaatgatgaaatca |
7665185 |
T |
 |
| Q |
217 |
caacatattgcacaccactatttgattcttctctttcctcatataccccttactttctcacaaagtggtcccactttgggtaaattttcttcaaacggtt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7665184 |
caacatattgcacaccactatttgattcttctctttcctcatataccccttactttctcacaaagtggtcccaccttgggtaaattttcttcaaacggtt |
7665085 |
T |
 |
| Q |
317 |
actcacccacccttctctcaatgtgc |
342 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
7665084 |
actcacccacccttctctcaatgtgc |
7665059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University