View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2085-Insertion-15 (Length: 217)
Name: NF2085-Insertion-15
Description: NF2085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2085-Insertion-15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 7 - 200
Target Start/End: Original strand, 35627430 - 35627624
Alignment:
| Q |
7 |
acttcatatagagagtctaacacattttctattaacagcaaaagggccatcaatgcaacacactaaaagttttacacggaagaaatatttccttgctaaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35627430 |
acttcatatagagagtctaacacattttctattaacagcaaaagggtcatcaatgcaacacactaaaagttttacacggaagaattatttccttgctaaa |
35627529 |
T |
|
| Q |
107 |
atatgnnnnnnnncttcttgtaatcaccattccatttagaagttaatcttcatctaataacataagcaaaatatcttaca--cgcactgtcaaaat |
200 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35627530 |
atatg-tttttttcttcttgtaatcaccattccatttagaagttaatcttgatctaataacataagcaaaatatcttacacgcgcactgtcaaaat |
35627624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University