View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2085-Insertion-16 (Length: 195)
Name: NF2085-Insertion-16
Description: NF2085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2085-Insertion-16 |
 | |
|
| [»] scaffold0014 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0014 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 8 - 195
Target Start/End: Original strand, 74873 - 75060
Alignment:
| Q |
8 |
aaagcaactgttttagtagttttggcttgcttcaaatcatgaataggtttcttagaaactttctgaacagtgtcttgcgtgttaataaagatcagtttca |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || |||||||||||| |||||| ||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
74873 |
aaagcaactgttttagtagttttggcttgcttcaaatcaggagtaggtttcttagcaactttttgaacagtgtcttacgtgttaataaagatcaatttca |
74972 |
T |
|
| Q |
108 |
tgcagttttgaacattatgacctaatatcttacaatgagcacaatataattgttgtttttcatactgcattactacattgaaagcatg |
195 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
74973 |
tgtagttttgaacattatgacctaatatcttacaatcagcacaatataattgttgtttttcatactgcattactacattgaaagcatg |
75060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 114 - 174
Target Start/End: Original strand, 25863642 - 25863702
Alignment:
| Q |
114 |
tttgaacattatgacctaatatcttacaatgagcacaatataattgttgtttttcatactg |
174 |
Q |
| |
|
|||||||| |||||||||| ||| | |||||||||||||| ||| | || ||||||||||| |
|
|
| T |
25863642 |
tttgaacactatgacctaacatcctgcaatgagcacaatacaatgggtgcttttcatactg |
25863702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University