View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2085-Insertion-18 (Length: 129)

Name: NF2085-Insertion-18
Description: NF2085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2085-Insertion-18
NF2085-Insertion-18
[»] chr8 (1 HSPs)
chr8 (8-124)||(36027063-36027175)


Alignment Details
Target: chr8 (Bit Score: 84; Significance: 2e-40; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 84; E-Value: 2e-40
Query Start/End: Original strand, 8 - 124
Target Start/End: Complemental strand, 36027175 - 36027063
Alignment:
8 atctatatatcagtgaatgactgagagagagttaagtcgaattagacacaagcatatatgtatgtatgtatacgtacatgcatatcagtccttcacagtt 107  Q
    |||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||    |||||||||||||||||||||||||||| ||||    
36027175 atctatatatcagtgaatgactgagagaaagttaagtccaattagacacaagcatatatgtat----gtatacgtacatgcatatcagtccttcatagtt 36027080  T
108 cacgggtctctgcttct 124  Q
    |||||||||||| ||||    
36027079 cacgggtctctgtttct 36027063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University