View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2085-Insertion-18 (Length: 129)
Name: NF2085-Insertion-18
Description: NF2085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2085-Insertion-18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 84; Significance: 2e-40; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 84; E-Value: 2e-40
Query Start/End: Original strand, 8 - 124
Target Start/End: Complemental strand, 36027175 - 36027063
Alignment:
| Q |
8 |
atctatatatcagtgaatgactgagagagagttaagtcgaattagacacaagcatatatgtatgtatgtatacgtacatgcatatcagtccttcacagtt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
36027175 |
atctatatatcagtgaatgactgagagaaagttaagtccaattagacacaagcatatatgtat----gtatacgtacatgcatatcagtccttcatagtt |
36027080 |
T |
 |
| Q |
108 |
cacgggtctctgcttct |
124 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
36027079 |
cacgggtctctgtttct |
36027063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University