View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20852_high_6 (Length: 328)
Name: NF20852_high_6
Description: NF20852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20852_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 12 - 297
Target Start/End: Complemental strand, 34635132 - 34634849
Alignment:
| Q |
12 |
atgaagtaggtgtaatatggttacgactatcgtaattataggtaataaacacccttatagtatttcttcnnnnnnnnnncacccttatttattgcatagt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34635132 |
atgaagtaggtgtaatatggttacgactatcgcaattataggtaataaacacccttatagtatttcttcaaaaaaaaaacacccttatttattgcatagt |
34635033 |
T |
|
| Q |
112 |
gttttgttgagtttatattacacaacattcaatcacttgaagctacattgttttatatattcaatttttggcaagtgtgaattcataatttggattaatt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |||||||||||||| |
|
|
| T |
34635032 |
gttttgttgagtttatattacacaacattcaatcacttgaagctacattgttttatatattcaagttttggcaagtg--aattcacaatttggattaatt |
34634935 |
T |
|
| Q |
212 |
tcctctgattagcatcaataaacgttaaagatattcgtcttttaagttttttatcattcgatcgtggccctttatattacaaagtt |
297 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34634934 |
ttctctgattagcatcaataaacgttaaagatattcgtcttttaagttttttatcattcgattgtggccctttatattacaaagtt |
34634849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University