View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20853_high_14 (Length: 330)
Name: NF20853_high_14
Description: NF20853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20853_high_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 11 - 301
Target Start/End: Original strand, 51755925 - 51756221
Alignment:
| Q |
11 |
caaagggaaagatgaagtttaccttgtattattatgac------gatgaagatgacattgacagagaatgcaaggaaagtgttgagacgttnnnnnnnnt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| | |
|
|
| T |
51755925 |
caaagggaaagatgaagtttaccttgtattattatgaccatgaagatgaagatgacattgacagagaatgcaaggagagtgttgagacgttaaaaaaaat |
51756024 |
T |
|
| Q |
105 |
aacggaggaattatgggaagagaaagagggaagattagggtggtgggagagttgggaaaacttgttgaggacaagaactggagagaacgaaggtgggtgg |
204 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51756025 |
aacggaggaattatgggaagagaaagaaggaagattagggtggtgggagagttgggaaaacttgttgaggacaagaactggagagaacgaaggtgggtgg |
51756124 |
T |
|
| Q |
205 |
tatacatgccaagatttaacggtgattaatggcaacgttgttaggttttgggatgaagatttcgagtttgcttcctttgcaaatggaggaatcaaat |
301 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51756125 |
tatacatgccaagatttaacggtgattaacggcaacgttgttaggttttgggatgaagagttcgagtttgcttcctttgcaaatggaggaatcaaat |
51756221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University