View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20853_high_4 (Length: 418)
Name: NF20853_high_4
Description: NF20853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20853_high_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 286; Significance: 1e-160; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 58 - 384
Target Start/End: Complemental strand, 38942563 - 38942241
Alignment:
| Q |
58 |
ctgtgttcgatgaggaactagaagctggtcgtgcattgatcgtgccacaaaactttgctgttgcagcaaaatcagtgagtgacaggttcacttatgtttc |
157 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38942563 |
ctgtgttcgatgaggaactagaagctggccgtgcattgatcgtgccacaaaactttgctgttgcagcaaaatcagtgagcgacaggttcacttatgtttc |
38942464 |
T |
|
| Q |
158 |
attcaagaccaatgataatgccgcgattgccaggcttgctgggacacaatccactctaagtggtatgccagtggatgtgcttgcagctacattcaacatg |
257 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38942463 |
attcaagaccaatgataatgccgcaattgccaggcttgcagggacacaatccactctaagtggtatgccagtggatgtgcttgcagctacattcaacatg |
38942364 |
T |
|
| Q |
258 |
gacaggaatgaggcaaggcagctcaaaatcaacaatctctttaaatttctagttccaccccgtgagtccgaacgcagagctgcagcttagaaacaaacaa |
357 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
38942363 |
gacaggaatgaggcaaggcagctcaaaaacaacaatctctttaaatttctagttccaccccgtgagtccgaacgcagagctgcagcttagaaaca----a |
38942268 |
T |
|
| Q |
358 |
acactgtttctaaggctttttgcatgc |
384 |
Q |
| |
|
|||| |||||||||||||||||||||| |
|
|
| T |
38942267 |
acaccgtttctaaggctttttgcatgc |
38942241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 173; E-Value: 7e-93
Query Start/End: Original strand, 58 - 346
Target Start/End: Complemental strand, 38949999 - 38949711
Alignment:
| Q |
58 |
ctgtgttcgatgaggaactagaagctggtcgtgcattgatcgtgccacaaaactttgctgttgcagcaaaatcagtgagtgacaggttcacttatgtttc |
157 |
Q |
| |
|
||||||| |||| ||||| ||||| ||||| | ||||| || |||||||| |||||||| || ||||||||| |||| ||||||||| ||||| || |
|
|
| T |
38949999 |
ctgtgtttgatggcgaacttgaagccggtcgcgtgttgatagtaccacaaaattttgctgtagctgcaaaatcaatgagcgacaggttccagtatgtgtc |
38949900 |
T |
|
| Q |
158 |
attcaagaccaatgataatgccgcgattgccaggcttgctgggacacaatccactctaagtggtatgccagtggatgtgcttgcagctacattcaacatg |
257 |
Q |
| |
|
||||||||||||||||||||| || ||||| |||||||| |||||||||||||||||||||||| ||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
38949899 |
attcaagaccaatgataatgctgccattgctaggcttgcagggacacaatccactctaagtggtgtgccaatggatgtgcttgcagctacatacaacatg |
38949800 |
T |
|
| Q |
258 |
gacaggaatgaggcaaggcagctcaaaatcaacaatctctttaaatttctagttccaccccgtgagtccgaacgcagagctgcagctta |
346 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38949799 |
gacaggaatgaggcaaggcagctcaagaacaacaatctctataaatttctagttccaccccgtgagtccgaacgcagagctgcagctta |
38949711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University