View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20856_high_2 (Length: 346)
Name: NF20856_high_2
Description: NF20856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20856_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 22 - 332
Target Start/End: Original strand, 38604386 - 38604697
Alignment:
| Q |
22 |
catcatcaacaataacgccgtttccatccacagaacctcttgtccatttgcgtgccacacttgccgccgatctactttctttccaaccccacctctctga |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38604386 |
catcatcaacaataacgccgtttccatccacagaacctcttgtccatttgcgtgccacacttgccgccgatctactttctttccaaccccacctctctga |
38604485 |
T |
 |
| Q |
122 |
cgtacacctctctcagttcaacacttcacgttttcatcaatttttacgnnnnnnnnattg-aaaagcttgttttttagtactactttgagctcagctagt |
220 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38604486 |
cgtacacctctctcagttcaacacttcccgttttcataaatttttacgtttttttttttggaaaagcttgttttttagtactactttgagctcagctagt |
38604585 |
T |
 |
| Q |
221 |
tttttctgttacatagttgttgatttgtaaaattggaagagttcatgattagttgcttgtactgttgtacttgattatgtggattgctcttaattggaac |
320 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38604586 |
tttttctgttacataattgttgatttgtaaaattggaagagttcatgattagttgcttgtactgttgtacttgattatgtggattgctcttaattggaac |
38604685 |
T |
 |
| Q |
321 |
catggttgtgtc |
332 |
Q |
| |
|
|||||||||||| |
|
|
| T |
38604686 |
catggttgtgtc |
38604697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University