View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20857_high_9 (Length: 321)
Name: NF20857_high_9
Description: NF20857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20857_high_9 |
 |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0003 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 30 - 311
Target Start/End: Original strand, 343297 - 343577
Alignment:
| Q |
30 |
ataagcccttgttttgaagttacgaaccgtctttccagtaagtacgtcgatttttaaagttactgtgcattagtttttgacatatggtttcagtttagct |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
343297 |
ataagcccttgttttgaagttacgaaccgtctttccagtaagtacgtcgatttttaaagttactgtgcactagtttttgacatatggtttcagtttagct |
343396 |
T |
 |
| Q |
130 |
ttaacctaggatttcagttctcactcgttacattgtactgatatctaattaggaatgcatcattttgcttctcaggaagctaaggttgcttacaccgggg |
229 |
Q |
| |
|
| ||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
343397 |
tcaacctaggatttcagttctcacttgttacattgtactgatatctaattagggatgcatcattttgcttctcaggaagctaaggttgcttacaccgggg |
343496 |
T |
 |
| Q |
230 |
agaaccatctgcgccgagaatgtgaaaaatgggaaaaatgttgcttcctcgttatagtgatcatgtcagtttatgacctttg |
311 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
343497 |
agaaccatctgcgccgagaaagtgaaaaatggg-aaaatgttgcttcctcgttatagtgatcatgtcagtttatgacctttg |
343577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University