View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20858_high_2 (Length: 358)

Name: NF20858_high_2
Description: NF20858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20858_high_2
NF20858_high_2
[»] chr3 (1 HSPs)
chr3 (14-329)||(1428868-1429197)
[»] chr2 (2 HSPs)
chr2 (39-227)||(13999144-13999332)
chr2 (249-319)||(11799651-11799721)


Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 14 - 329
Target Start/End: Original strand, 1428868 - 1429197
Alignment:
14 gaagaccagctgagcaccaccacagatacggtttctctggtggcgagattggagaagataccaacgagcatagatatggagacaaagcattaaaatgatg 113  Q
    ||||||||||||||||| |  || ||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
1428868 gaagaccagctgagcacgatgacggatacggtttctccggtggcgagattggagaagataccaacgagcataaatatggagacaaagcattaaaatgatg 1428967  T
114 ttgaaaaagagaaggactttagcgtagatcatgattttgctgttgcgattgtaaccctttccgccataatcgttgggaggcttttaatctttggtgaatt 213  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
1428968 ttgaaaaagagaaggactttagcgtagatcatgattttgctgttgcgattgtaaccctttgcgccataatcgttgggaggcttttaatctttggtgaatt 1429067  T
214 tgggtatgggttcaaaacctgaaacc--------------aatcccctcgtggactgttgattccgccggtgtaagcttcgaattgatcgaagggttgtt 299  Q
    ||||||||||||||||||||||||||              |||||||| |||||| |||||||||||| |||||| ||||||||||||||||||||||||    
1429068 tgggtatgggttcaaaacctgaaaccaatccccttgaccgaatccccttgtggaccgttgattccgcccgtgtaaacttcgaattgatcgaagggttgtt 1429167  T
300 ctgcgccataggaggagcaggagcagaatg 329  Q
    |||||||  |||||||||||||||||||||    
1429168 ctgcgccgcaggaggagcaggagcagaatg 1429197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 73; Significance: 3e-33; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 39 - 227
Target Start/End: Original strand, 13999144 - 13999332
Alignment:
39 atacggtttctctggtggcgagattggagaagataccaacgagcatagatatggagacaaagcattaaaatgatgttgaaaaagagaaggactttagcgt 138  Q
    |||||||||||| || | |||||||||||||| ||||||||||| || |||||||||||||||||||| |  ||| |||| ||||||||||   | ||      
13999144 atacggtttctccggcgacgagattggagaaggtaccaacgagcgtaaatatggagacaaagcattaatactatgatgaagaagagaaggataatggcac 13999243  T
139 agatcatgattttgctgttgcgattgtaaccctttccgccataatcgttgggaggcttttaatctttggtgaatttgggtatgggttca 227  Q
    ||| ||||||||||| |||| |||||||||| |||  | || ||||||||||||| |||| |||| ||| |||||||||||||||||||    
13999244 agagcatgattttgccgttgagattgtaaccttttgggtcaaaatcgttgggagggttttgatctctggggaatttgggtatgggttca 13999332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 249 - 319
Target Start/End: Complemental strand, 11799721 - 11799651
Alignment:
249 gtggactgttgattccgccggtgtaagcttcgaattgatcgaagggttgttctgcgccataggaggagcag 319  Q
    |||||| ||||||||||  |||||||| |||||||||||||||| | |||||||||||  | |||||||||    
11799721 gtggaccgttgattccgatggtgtaagtttcgaattgatcgaagtgctgttctgcgccgcatgaggagcag 11799651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University