View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20858_high_6 (Length: 303)
Name: NF20858_high_6
Description: NF20858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20858_high_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 11 - 274
Target Start/End: Complemental strand, 40593205 - 40592942
Alignment:
| Q |
11 |
caaaggtaacttacaacttattgcatatatatcttcttctcgtagtcgtagaccaattcatccattgccaggatgcgtaccgtaatccttgcgaggtatg |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40593205 |
caaaagtaacttacaacttattgcatatatatcttcttctcgtagtcgtagaccaattcatccattgccaggatgcgtaccgtaatccttgcgaggtatg |
40593106 |
T |
|
| Q |
111 |
taatgatgatcattatcgtcattgacaccaaaatggctagatccaccgggtttcgcaaagtccttccgagaaggaggagttgggattcgacggtgattct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40593105 |
taatgatgatcattatcgtcattgacaccaaaatggctagatccaccgggtttcccaaagtccttccgagaaggaggagttgggattcgatggtgattct |
40593006 |
T |
|
| Q |
211 |
tgaggtcaataagttcatgatctctttccatgccttgctcttgtttctggttttcagacatttg |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40593005 |
tgaggtcaataagttcatgatctctttccatgccttgctcttgtttctggttttcagacatttg |
40592942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University