View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20859_high_2 (Length: 495)
Name: NF20859_high_2
Description: NF20859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20859_high_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 415; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 415; E-Value: 0
Query Start/End: Original strand, 1 - 470
Target Start/End: Original strand, 23889035 - 23889505
Alignment:
| Q |
1 |
tcataaaactagactgctgtttggcaatgcatgtattgttatgccctccaaaagatgatcctgcaatttgcctaacatgtagtgttatcaattttcagcg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23889035 |
tcataaaactagactgctgtttggcaatgcatgtattgttatgccctccaaaagatgatcctgcaatttgcctaacaggtagtgttatcaattttcagcg |
23889134 |
T |
|
| Q |
101 |
atcagtttcaagattcggtagacagtgggtttatgggcgtattcaccttgtttcaccgagaggaagatcccaacgccaaaggcaactgtaaattaccttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23889135 |
atcagtttcaagattcggtagacagtgggtttatgggcgtattcaccttgtttcaccgagaggaagatcccaacgccaaaggcaactgtaaattaccttt |
23889234 |
T |
|
| Q |
201 |
tcagcttttgtgatttgcttcagcaatagtcaatagcaaggatatgaataccatcaa-cttttttcaacagtttttgcctgaaaccaatttgatatactt |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
23889235 |
tcagcttttgtgatttgcttcagcaatagtcaatagcaaggatatgaatagcatcaatttttttttaacagtttttgcctgaaaccaatttgatatactt |
23889334 |
T |
|
| Q |
300 |
tttgtaaggacgaagtggacatgttgggatggacaattatttctttgatttgaatgcaaattcaattggtactgtgcaagattttggagtttgatatgca |
399 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
23889335 |
tttgtaaggacgaagtggacatgttgggatggacaattatttctttgatttgaatgcaaattcaattggtactgtgcaagattttgcagtttgatatgca |
23889434 |
T |
|
| Q |
400 |
acnnnnnnnnacataattcatttgatagcagatcttaagtagaatgtccatgtttattaatttcatttgat |
470 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
23889435 |
acttttttttacataattcatttgatagcagatcttaagtagaatgtccatgtttatttatttcatttgat |
23889505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University