View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2085R-Insertion-10 (Length: 183)
Name: NF2085R-Insertion-10
Description: NF2085R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2085R-Insertion-10 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 8 - 183
Target Start/End: Complemental strand, 34637245 - 34637070
Alignment:
| Q |
8 |
agttttctccaataagttccggaaggagcaaaaccaatggcacgctcgaacataagcaagcgtgccgaatctttgatcggacggtcagaaaaagacgatc |
107 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34637245 |
agttttctccaataggttccggaaggagcaaaaccaatggcacgctcgaacataagcaagcctgctgaatctttgatcggacggtcagaaaaagacgatc |
34637146 |
T |
|
| Q |
108 |
cgaatagaatttctcttgcagtttcagggtggctacttataacaactcgtgtggctcctagacttaacgccattaa |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34637145 |
cgaatagaatttctcttgcagtttcagggtggctacttataacaactggtgtggctcctagacttaacgccattaa |
34637070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University