View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2085R-Insertion-12 (Length: 97)
Name: NF2085R-Insertion-12
Description: NF2085R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2085R-Insertion-12 |
 |  |
|
| [»] chr4 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 85; Significance: 4e-41; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 85; E-Value: 4e-41
Query Start/End: Original strand, 9 - 97
Target Start/End: Original strand, 20369189 - 20369277
Alignment:
| Q |
9 |
aatggcttcccgccaacctcatactttcgaggcctccctctgcccctttttaccggagcatattccgaacctacagatttggactttgc |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
20369189 |
aatggcttcccgccaacctcatactttcgaggcctccctctgcccctttttaccggagcagattccgaacctacagatttggactttgc |
20369277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 85; E-Value: 4e-41
Query Start/End: Original strand, 9 - 97
Target Start/End: Original strand, 20389490 - 20389578
Alignment:
| Q |
9 |
aatggcttcccgccaacctcatactttcgaggcctccctctgcccctttttaccggagcatattccgaacctacagatttggactttgc |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
20389490 |
aatggcttcccgccaacctcatactttcgaggcctccctctgcccctttttaccggagcagattccgaacctacagatttggactttgc |
20389578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 81; E-Value: 1e-38
Query Start/End: Original strand, 9 - 97
Target Start/End: Original strand, 20377118 - 20377206
Alignment:
| Q |
9 |
aatggcttcccgccaacctcatactttcgaggcctccctctgcccctttttaccggagcatattccgaacctacagatttggactttgc |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
20377118 |
aatggcttcccgccaacctcatactttcgaggcctccctctgcccctttttaccggagcagattctgaacctacagatttggactttgc |
20377206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University