View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2085R-Insertion-7 (Length: 306)
Name: NF2085R-Insertion-7
Description: NF2085R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2085R-Insertion-7 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 8 - 306
Target Start/End: Complemental strand, 38284940 - 38284642
Alignment:
| Q |
8 |
agtagtatgttggtggaaggtggatgaaggaccaaaatggataaccttcttgtactgatgaagccacggcttaaccaccacaacagagttaaacattctt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38284940 |
agtagtatgttggtggaaggtggatgaaggaccaaaatggataaccttcttgtactgatgaagccacggcttaaccaccacaacagagttaaacattctt |
38284841 |
T |
|
| Q |
108 |
tgaacaccattatgatcaacggctgagatgttgagatagtatttcatcccagacaccacttgctgctcagcctccaccacttccacgaacttcaacccct |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38284840 |
tgaacaccattatgatcaacggctgagatgttgagatagtatttcatcccagacaccacttgctgctcagcctccaccacttccacgaacttcaacccct |
38284741 |
T |
|
| Q |
208 |
ctccaccgccgccgttgttcaaaccttgtttgtagttgtactccttcaccgcaaacttccctagctcttgcacctccttgtttgtccccacgtcactga |
306 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38284740 |
ctccgccgccgccgttgttcaaaccttgtttgtagttgtactccttcaccgcaaacttccctagctcttgcacctccttgtttgtccccacgtcactga |
38284642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University