View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2085R-Insertion-8 (Length: 205)
Name: NF2085R-Insertion-8
Description: NF2085R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2085R-Insertion-8 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 88 - 205
Target Start/End: Original strand, 3448930 - 3449047
Alignment:
| Q |
88 |
tatatttaatgtagctatcatcttttctggcttccattatatggattgtgaagtgtagactatgctaaagttnnnnnnnnntgaaaagaaggagacaatt |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3448930 |
tatatttaatgtagctatcatcttttctggcttccattatatggattgtgaagtgtagactatgctaaagttaaaaaaaaatgaaaagaaggagacaatt |
3449029 |
T |
|
| Q |
188 |
tgggtgtttgttttgacg |
205 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
3449030 |
tgggtgtttgttttgacg |
3449047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 73; E-Value: 1e-33
Query Start/End: Original strand, 8 - 96
Target Start/End: Original strand, 3448551 - 3448639
Alignment:
| Q |
8 |
atatctcgtggtaaatttagcgatggacttaaggtcgtaacaataagagggaaggaagaaaaatagaaagaaaattagaatatatttaa |
96 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3448551 |
atatctcgtggtaggtttacggatggacttaaggtcgtaacaataagagggaaggaagaaaaatagaaagaaaattagaatatatttaa |
3448639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University