View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2085_1D_high_17 (Length: 202)
Name: NF2085_1D_high_17
Description: NF2085_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2085_1D_high_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 185
Target Start/End: Original strand, 25708201 - 25708385
Alignment:
| Q |
1 |
tatcttcaatatgaaggactctttgatctctcatagttgaagtgtttgggtgaactctcttgtcacactagtacttaatattgtacaataactttatgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25708201 |
tatcttcaatatgaaggactctttgatctctcatagttgaagtgtttgggtgaactctcttgtcacactagtacttaatattgtacaataactttatgat |
25708300 |
T |
|
| Q |
101 |
cggttaataaataccactaacatcattcaatttgcattgggatcaatttatgtgtatgattgattaattggggtggtggcagaaa |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25708301 |
cggttaataaataccactaacatcattcaatttgcattgggatcaatttatgtgtatgattgattaattggggtggtggcagaaa |
25708385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University