View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2085_1D_high_9 (Length: 271)
Name: NF2085_1D_high_9
Description: NF2085_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2085_1D_high_9 |
 |  |
|
| [»] scaffold0743 (1 HSPs) |
 |  |  |
|
| [»] scaffold1104 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0743 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: scaffold0743
Description:
Target: scaffold0743; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 7 - 236
Target Start/End: Original strand, 6148 - 6377
Alignment:
| Q |
7 |
tgatcatatgttttgcattgaattcaatgtgatgagcttgcttccaaagacctagccatctttttgagaggatgttgcatctcacagcttcgtcaacatg |
106 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6148 |
tgatcatgtgttttgcattgaattcaatgtgatgagcttgcttccatagacctagccatctttttgagaggatgttgcatctcacagcttcgtcaacatg |
6247 |
T |
 |
| Q |
107 |
aagtttggaaaggatgaaggttaagacatcatttggaagcttgttgataaaatcttgtttctcatcactcataaccaccatcttttccatctctatgtct |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6248 |
aagtttggaaaggatgaaggttaagacatcatttggaagcttgttgataaactcttgtttctcatcactcataaccaccatcttttccatctccatgtct |
6347 |
T |
 |
| Q |
207 |
ctattgcaccctctctctttccctcaacct |
236 |
Q |
| |
|
||||||||||||||||| ||||||||||| |
|
|
| T |
6348 |
ctattgcaccctctctcaatccctcaacct |
6377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1104 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: scaffold1104
Description:
Target: scaffold1104; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 7 - 46
Target Start/End: Complemental strand, 286 - 247
Alignment:
| Q |
7 |
tgatcatatgttttgcattgaattcaatgtgatgagcttg |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
286 |
tgatcatatgttttgcattgaattcaatgtgatgagcttg |
247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1104; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 189 - 252
Target Start/End: Complemental strand, 246 - 182
Alignment:
| Q |
189 |
ttttccatctctatgtctctattgcaccctctctctttccctcaa--cctctcccaagagctattg |
252 |
Q |
| |
|
|||||||||||| | ||||||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
246 |
ttttccatctctttatctctattgca-cctctctctttccctcaaattgtctcccaagagctattg |
182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 206 - 254
Target Start/End: Original strand, 30374894 - 30374944
Alignment:
| Q |
206 |
tctattgcaccctctctctttccctcaac--ctctcccaagagctattgta |
254 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30374894 |
tctattgcaccctctctctttccctcaacctctctcccaagagctattgta |
30374944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 206 - 254
Target Start/End: Original strand, 30376747 - 30376797
Alignment:
| Q |
206 |
tctattgcaccctctctctttccctcaac--ctctcccaagagctattgta |
254 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30376747 |
tctattgcaccctctctctttccctcaacctctctcccaagagctattgta |
30376797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University