View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2085_1D_low_12 (Length: 356)

Name: NF2085_1D_low_12
Description: NF2085_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2085_1D_low_12
NF2085_1D_low_12
[»] chr2 (1 HSPs)
chr2 (7-71)||(16737529-16737593)


Alignment Details
Target: chr2 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 7 - 71
Target Start/End: Complemental strand, 16737593 - 16737529
Alignment:
7 ctgagatgaactaagagataaatctacaatttacatgttgatcactttctatggctctctctttt 71  Q
    ||||| ||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
16737593 ctgaggtgagctaagagataaatctacaattgacatgttgatcactttctatggctctctctttt 16737529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University