View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2085_1D_low_13 (Length: 333)
Name: NF2085_1D_low_13
Description: NF2085_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2085_1D_low_13 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 305; Significance: 1e-172; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 305; E-Value: 1e-172
Query Start/End: Original strand, 1 - 333
Target Start/End: Original strand, 40233553 - 40233885
Alignment:
| Q |
1 |
agtaagaatgtaaagattccaccgaagaaaaagcggatgatttttccgcataagttgaaacaaacggctaagcgtgttcatgcgtcagctgtggagtcgc |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40233553 |
agtaagaatgtcaagattccaccgaagaaaaagcggatgatttttccgaataagttgaaacaaacggctaagcgtgttcatgcgtcagctgtggagtcgc |
40233652 |
T |
 |
| Q |
101 |
cattagatgatgactctacaagaccatggcagtcggatgcagggatgctggatgcagcaccgtcccctgcattgatccttcaccatcagcacatgcgcgg |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
40233653 |
cattagatgatgacgctacaagaccatggcagtcggatgcaggggagctggatgcagcaccgtcccctgcattgatccttcaccatcagcacatgcgccg |
40233752 |
T |
 |
| Q |
201 |
tggcatacgacggatctgaacaatcaattggcttcagtgcatgagcacaacagtggaggtaaagaaccagcacatttcaacccagaatcatgagaaaccg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40233753 |
tggcatacgacggatctgaacaatcaatcggcttcagtgcatgagcacaacagtggaggtaaagaaccagcacatttcaacccagaatcatgagaaaccg |
40233852 |
T |
 |
| Q |
301 |
gtcaacaaagttcacggatttgctttttgtttt |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
40233853 |
gtcaacaaagttcacggatttgctttttgtttt |
40233885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University