View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2085_1D_low_15 (Length: 318)
Name: NF2085_1D_low_15
Description: NF2085_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2085_1D_low_15 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 22 - 318
Target Start/End: Original strand, 11680861 - 11681156
Alignment:
| Q |
22 |
atggcagggataaacgtttatttgtttcgatcttgaggttgcagttgaatgtgttttttgaaccaatggagaggagactgcccttcaccttttcctgcac |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11680861 |
atggcagggataaacgtttatttgtttcgatcttgaggttgcagatgaatgtgttttttgaaccaatggagaggagactgcccttcaccttttcctgcac |
11680960 |
T |
|
| Q |
122 |
tagccggttactgccttattgtgggcgaaatgattctcttagttaagggtcaatctcatcacaccactgaactcattgattcaaactgagtatttgttgg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11680961 |
tagccggttactgccttattgtgggcgaaatgattctcttagttaagggtcaatctcatcacaccactgaactcattgattcaaactgagtatttgttgg |
11681060 |
T |
|
| Q |
222 |
atggtgtccttaaaagaaattggaaaaaggctattggcttatttcgcatgcggctatatgaaaggcgcgaaatggaatgatttttcttatgataagg |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
11681061 |
atggtgtccttaaaagaaattggaaaaaggctattggcttatttggcatgcggctatatgaaaggcgcgaaatggaatgattttt-ttatgataagg |
11681156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University