View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2085_1D_low_18 (Length: 300)
Name: NF2085_1D_low_18
Description: NF2085_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2085_1D_low_18 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 20 - 300
Target Start/End: Complemental strand, 34349669 - 34349390
Alignment:
| Q |
20 |
ccatcagcacatatgcaggatttgggataagatatcgactttcaactgcctgttgtggagatgaccgctacgctggatgatttgacgtgtcttttataca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34349669 |
ccatcagcacatatgcaggatttgggataagataacgactttcatctgcctgttgtggagatgaccgctacgctggatgatttgacgtgtcttttataca |
34349570 |
T |
 |
| Q |
120 |
tccccgttgaagggaaaatgatggatcacgagnnnnnnnntctctcaggagacgggtatccagttgatgattgacttgtttggtgttgtcgagcatactg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34349569 |
tccccgttgaagggaaaatgatggatcacgagaaaaaga-tctctcaggagacgggtatccagttgacgattgacttgtttggtgttgtcgagcatactg |
34349471 |
T |
 |
| Q |
220 |
cgattgatgagagagctaactagtttggtgctttttcaaatattcccttcctaaagagaatacgtgaggagcacctcaata |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34349470 |
cgattgatgagagagctaactagtttggtgctttttcaaatattcccttcctaaagagaatacgcgaggagcacctcaata |
34349390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 199 - 300
Target Start/End: Original strand, 16782302 - 16782403
Alignment:
| Q |
199 |
ttggtgttgtcgagcatactgcgattgatgagagagctaactagtttggtgctttttcaaatattcccttcctaaagagaatacgtgaggagcacctcaa |
298 |
Q |
| |
|
||||||||||||||||| ||| ||||||||| | | | || ||||||| | |||| ||||||||| |||||||| ||||| ||| ||||||||||| |
|
|
| T |
16782302 |
ttggtgttgtcgagcatcgtgcaattgatgagtgtgatcaccagtttggggattttataaatattccactcctaaagggaatatatgacgagcacctcaa |
16782401 |
T |
 |
| Q |
299 |
ta |
300 |
Q |
| |
|
|| |
|
|
| T |
16782402 |
ta |
16782403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University