View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2085_1D_low_21 (Length: 284)
Name: NF2085_1D_low_21
Description: NF2085_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2085_1D_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 7e-55; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 83 - 191
Target Start/End: Original strand, 38284832 - 38284940
Alignment:
| Q |
83 |
tggtgttcaaagaatgtttaactctgttgtggtggttaagccgtggcttcatcagtacaagaaggttatccattttggtccttcatccaccttccaccaa |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38284832 |
tggtgttcaaagaatgtttaactctgttgtggtggttaagccgtggcttcatcagtacaagaaggttatccattttggtccttcatccaccttccaccaa |
38284931 |
T |
|
| Q |
183 |
catactact |
191 |
Q |
| |
|
||||||||| |
|
|
| T |
38284932 |
catactact |
38284940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University