View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2085_1D_low_22 (Length: 277)
Name: NF2085_1D_low_22
Description: NF2085_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2085_1D_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 5 - 253
Target Start/End: Original strand, 37202582 - 37202830
Alignment:
| Q |
5 |
cagtattgtctccgtttcgcgaccggagacgggagaaataagcccgattctactttcctatacaattgagttgcagtataaacaggcatgcaaatttgtt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37202582 |
cagtattgtctccgtttcgcgaccggagacgggagaaataagcccgattctactttcctatacaattgagttgcagtataaacaggcatgcaaatttgtt |
37202681 |
T |
|
| Q |
105 |
tacannnnnnnnnnnnnnnncttcttgaaatttagcgggaaaattgaatcaattgctatggttttcgtttttagttgtgttgttcagaacgagtttcaag |
204 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37202682 |
tacatttttgtttttcttttcttcttgaaatttagcgggaaaattgaatcaattgctatggttttcgtttttagttgtgttgttcagaacgagtttcaag |
37202781 |
T |
|
| Q |
205 |
gaattcttgtgcctggaaatggaaaactatatatattattagcaaattc |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37202782 |
gaattcttgtgcctggaaatggaaaactatatatattattagcaaattc |
37202830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University