View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2085_1D_low_33 (Length: 240)
Name: NF2085_1D_low_33
Description: NF2085_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2085_1D_low_33 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 17 - 240
Target Start/End: Complemental strand, 41729695 - 41729472
Alignment:
| Q |
17 |
acatcaaaaaaccaaatgctacaagcccaagtaaactgccaacaatactaattcccagcagtgctgtttcacttagcctcccacgtttctcagacctcga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41729695 |
acatcaaaaaaccaaatgctacaagcccaagtaaactgccaacaatactaattcccagcagtgctgtttcacttagcctcccacgtttctcagacctcga |
41729596 |
T |
|
| Q |
117 |
agaaggctcataaaccggcgaaagcacaggcgaaacggcagtaaaatttctgagagtaatgttattcccaacaaacgctgaatcaggaaacctttgtaaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41729595 |
agaaggctcataaaccggcgaaagcacaggcgaaacggcagtaaaatttctgagagtaatgttattcccaacaaacgctgaatcaggaaacctttgtaaa |
41729496 |
T |
|
| Q |
217 |
gatttaggcacagtaccatgtaaa |
240 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
41729495 |
gatttaggcacagtaccatgtaaa |
41729472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University