View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2085_1D_low_36 (Length: 234)
Name: NF2085_1D_low_36
Description: NF2085_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2085_1D_low_36 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 9 - 210
Target Start/End: Complemental strand, 14239139 - 14238938
Alignment:
| Q |
9 |
gaatcaatgagatgcttaggagaaggtgtgtggatgagaaggctgttgtgagaaaagcagctcttttgtttgttactaatttgactgctctacttggagg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14239139 |
gaatcaatgagatgcttaggagaaggtgtgtggatgagaaggctgttgtgagaaaagcagctcttttgtttgttactaatttgactgctctacttggagg |
14239040 |
T |
|
| Q |
109 |
tgctattgatgaagtggtgctgaagacaatgggaatggcctgttccgattcacttctaagcattcgtaaagcagctgctgcagctctttctgaggtactt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14239039 |
tgctattgatgaagtggtgctgaagacaatgggaatggcctgttccgattcacttctaagcattcgtaaagcagctgctgcagctctttctgaggtactt |
14238940 |
T |
|
| Q |
209 |
tt |
210 |
Q |
| |
|
|| |
|
|
| T |
14238939 |
tt |
14238938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 9 - 203
Target Start/End: Complemental strand, 45323266 - 45323072
Alignment:
| Q |
9 |
gaatcaatgagatgcttaggagaaggtgtgtggatgagaaggctgttgtgagaaaagcagctcttttgtttgttactaatttgactgctctacttggagg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| ||||||||| |||||||||| ||||||||||| |||||||| |
|
|
| T |
45323266 |
gaatcaatgagatgcttaggagaaggtgtgtggacgagaaggcgattgtgagaaaagctgctcttttgcttgttactaacttgactgctctgcttggagg |
45323167 |
T |
|
| Q |
109 |
tgctattgatgaagtggtgctgaagacaatgggaatggcctgttccgattcacttctaagcattcgtaaagcagctgctgcagctctttctgagg |
203 |
Q |
| |
|
||||| ||||||||||| ||| ||||||||||| ||||| ||||||||||||||| | |||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
45323166 |
tgctactgatgaagtggggctaaagacaatgggtatggcttgttccgattcacttgttagcattcggaaagcggctgctgcagctctttctgagg |
45323072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University