View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2085_1D_low_42 (Length: 230)
Name: NF2085_1D_low_42
Description: NF2085_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2085_1D_low_42 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 760402 - 760611
Alignment:
| Q |
1 |
aactctcaatgttgcactttttcacctttgccgcacaatggacattcccact--ttcagaatacctcagactcatgttgaaggagccaagcttattaccc |
98 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
760402 |
aactctcaacgttgcactttttcacctttgccgcacaatggacattcccactctttcagaatacctcagactcatgttgaaggagccaagcttattaccc |
760501 |
T |
|
| Q |
99 |
tggtaacataacttttaacaaggttttggaatccatttgtaaattgaatgatgatgtcatgccacaagtgtatcagctttttctttaacatgattcaaac |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
760502 |
tggtaacataacttttaacaaggttttggaatccatttgtaaattgaatgatgatgtcatgccacaagtgtatcagctttttctttaacatgattcaaac |
760601 |
T |
|
| Q |
199 |
ggattgttct |
208 |
Q |
| |
|
| |||||||| |
|
|
| T |
760602 |
gtattgttct |
760611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 110 - 147
Target Start/End: Original strand, 5934691 - 5934728
Alignment:
| Q |
110 |
cttttaacaaggttttggaatccatttgtaaattgaat |
147 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5934691 |
cttttaacaaggttctggaatccatttgtaaattgaat |
5934728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University