View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2085_1D_low_43 (Length: 229)
Name: NF2085_1D_low_43
Description: NF2085_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2085_1D_low_43 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 18 - 229
Target Start/End: Complemental strand, 36982247 - 36982037
Alignment:
| Q |
18 |
ccatttttatgtttggtaccggtttctatcaaagtataatagtgcatgcatgtattggtggtatgtttgtcgaatttgtggggtccacttattaaaattg |
117 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36982247 |
ccatttctatgtttggtactggtttctatcaaagtataatagtgcatgcatgtattggtggtatgtttggcgaatttgtggggtccacttattaaaattg |
36982148 |
T |
|
| Q |
118 |
gtcacactaatatgtcacttgtgtctatctctctctcataattaatggaggaagatagataaatggagcaaatctgaactcgattttattaaac-aaagt |
216 |
Q |
| |
|
||||||||||| | ||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36982147 |
gtcacactaatctatcacttgtggctatctc--tctcataattaatggaggaagatagataaatggagcaaatctgaactcgattttattaaactaaagt |
36982050 |
T |
|
| Q |
217 |
ttagtttttgcta |
229 |
Q |
| |
|
||||||||||||| |
|
|
| T |
36982049 |
ttagtttttgcta |
36982037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 97 - 151
Target Start/End: Complemental strand, 23746139 - 23746085
Alignment:
| Q |
97 |
ggggtccacttattaaaattggtcacactaatatgtcacttgtgtctatctctct |
151 |
Q |
| |
|
||||||||||||||||||| |||| ||||||| | |||||||||||||||||||| |
|
|
| T |
23746139 |
ggggtccacttattaaaatgggtcccactaatctatcacttgtgtctatctctct |
23746085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 152
Target Start/End: Complemental strand, 10631219 - 10631169
Alignment:
| Q |
102 |
ccacttattaaaattggtcacactaatatgtcacttgtgtctatctctctc |
152 |
Q |
| |
|
|||||||| ||||| |||| ||||||| | ||||||||||||||||||||| |
|
|
| T |
10631219 |
ccacttatgaaaatgggtctcactaatctatcacttgtgtctatctctctc |
10631169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 199
Target Start/End: Complemental strand, 9853966 - 9853938
Alignment:
| Q |
171 |
gatagataaatggagcaaatctgaactcg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9853966 |
gatagataaatggagcaaatctgaactcg |
9853938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 99 - 148
Target Start/End: Complemental strand, 17356370 - 17356321
Alignment:
| Q |
99 |
ggtccacttattaaaattggtcacactaatatgtcacttgtgtctatctc |
148 |
Q |
| |
|
||||||||||||||||| |||| ||||||| | |||||||| |||||||| |
|
|
| T |
17356370 |
ggtccacttattaaaataggtcccactaatttatcacttgtatctatctc |
17356321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University