View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2085_1D_low_47 (Length: 226)
Name: NF2085_1D_low_47
Description: NF2085_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2085_1D_low_47 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 146; Significance: 5e-77; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 8 - 209
Target Start/End: Complemental strand, 4708365 - 4708164
Alignment:
| Q |
8 |
tgatattaaaaccttaatggtattgaatccatgaccannnnnnnnaaagaagaatccatgataattttgcagatagtcgttgacgccctaattgatccta |
107 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||| || ||||||||||||||||| ||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
4708365 |
tgatatgaaaaccttaatggtatagaatccatgatcattttttttaaagaagaatccatgatcattttgcagatagtcgttgacaccctacttgatccta |
4708266 |
T |
|
| Q |
108 |
aagtggttataagatatgacccaaagtcactggttagagatcttgctgacctaatagagagatacacgaagtcgcaggttactggctgaaacatactttt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
4708265 |
aagtggttataagatatgacccaaagtcactggttagagatcttgctgacctaatagagagatacacgaagtcgcaagttactggctgaatcatactttt |
4708166 |
T |
|
| Q |
208 |
ga |
209 |
Q |
| |
|
|| |
|
|
| T |
4708165 |
ga |
4708164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 73 - 188
Target Start/End: Complemental strand, 4745984 - 4745869
Alignment:
| Q |
73 |
tttgcagatagtcgttgacgccctaattgatcctaaagtggttataagatatgacccaaagtcactggttagagatcttgctgacctaatagagagatac |
172 |
Q |
| |
|
|||||||||||| |||||| ||||| ||||||||||||||| ||||| |||||| |||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
4745984 |
tttgcagatagttgttgactccctacttgatcctaaagtgggtataatatatgatccaaagtcactgattagagctcttgctgacctaatagagagatac |
4745885 |
T |
|
| Q |
173 |
acgaagtcgcaggtta |
188 |
Q |
| |
|
| |||||||| |||| |
|
|
| T |
4745884 |
ataaagtcgcatgtta |
4745869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University