View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2085_1D_low_59 (Length: 216)
Name: NF2085_1D_low_59
Description: NF2085_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2085_1D_low_59 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-103
Query Start/End: Original strand, 6 - 198
Target Start/End: Original strand, 16842774 - 16842966
Alignment:
| Q |
6 |
gagatgaagctgaacaagcacattgtttgtacaaggatcgatatttatagtgttatgggacgcttcaaagatgcagagatgttacatctaaagttgaaga |
105 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16842774 |
gagaagaagctgaacaagcacattgtttgtacaaggatcgatatttatagtgttatgggacgcttcaaagatgcagagatgttacatctaaagttgaaga |
16842873 |
T |
|
| Q |
106 |
tgtcttcttcaccaaattcgttggatgtgattgcatatagcattgttgtgcggaggttgtattttatgcctaagaaacaaggcttggttgatg |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16842874 |
tgtcttcttcaccaaattcgttggatgtgattgcatatagcattgttgtgcggaggttgtattttatgcctaagaaacaaggcttggttgatg |
16842966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 122; Significance: 9e-63; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 6 - 159
Target Start/End: Original strand, 24209686 - 24209839
Alignment:
| Q |
6 |
gagatgaagctgaacaagcacattgtttgtacaaggatcgatatttatagtgttatgggacgcttcaaagatgcagagatgttacatctaaagttgaaga |
105 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||||||||||||||||| |||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
24209686 |
gagaagaagctgaacaagcacattgtttgtacaatgatcgatatttatagtgtcatgggatgcttcaaagatgcagagatgttgtatctaaagttgaaga |
24209785 |
T |
|
| Q |
106 |
tgtcttcttcaccaaattcgttggatgtgattgcatatagcattgttgtgcgga |
159 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
24209786 |
agtcttcttcaccaaattcgttggatatgattgcatatagcattgttgtgcgga |
24209839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 198
Target Start/End: Original strand, 24210191 - 24210232
Alignment:
| Q |
157 |
ggaggttgtattttatgcctaagaaacaaggcttggttgatg |
198 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24210191 |
ggaggttgtattttatggctaagaaacaaggcttggttgatg |
24210232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University